upload
Food and Agriculture Organization of the United Nations
Industry: Agriculture
Number of terms: 87409
Number of blossaries: 0
Company Profile:
Established in October 1945 with the objective of eliminating hunger and improving nutrition and standards of living by increasing agricultural productivity, FAO coordinates the efforts of governments and technical agencies in programs for developing agriculture, forestry, fisheries, and land and ...
Ciśnienie, że ściany komórkowej wywiera przeciwko turgor zawartość komórki. Ściana ciśnienie jest równe i przeciwne potencjalnych turgor.
Industry:Biotechnology
Wstępnego rozwiązania (np. witamina C, kwas cytrynowy), które opóźnia starzenie i brązowienia tkanki. To jest zatrudniony do inkubacji mikropropagacji przed powierzchni sterylizacji.
Industry:Biotechnology
L'estat de insusceptibility relativa d'un animal o planta a les infeccions mitjançant la producció de malaltia organismes o als efectes nocius de la seva verins.
Industry:Biotechnology
Els passos en la producció viral que sol conduir a la lisi de la cèl lula.
Industry:Biotechnology
La cadena d'ADN que és sintetitzat contínuament durant la replicació.
Industry:Biotechnology
La cadena d'ADN que és sintetitzat manera discontínua durant la replicació (perquè la síntesi d'ADN pugui procedir només en la 5´ a la direcció de 3´).
Industry:Biotechnology
La cadena de dúplex l'ADN que conté la seqüència de bases mateix (després de la substitució de U per a T) es troba en la molècula d'ARNm resultant de la transcripció d'aquest segment d'ADN. àlies sentit strand. Molècula de l'ARNm és transcrit a partir l'altra cadena, coneguda com la cadena de plantilla o bé negatius.L'ARNm de Coding strand 5´ ATGAAAGCTTTAGTGGGCGCCCGTAT 3´ plantilla strand 3´ TACTTTCGAAATCACCCGCGGGCATA 5´ 5´ AUGAAAGCUUUAGUGGGCGCCCGUAU 3´
Industry:Biotechnology
Egysejtű növények, mint például a <i>Chlorella</i> spp. és <i>Spirulina</i> spp., kereskedelmileg termesztett tavak, hogy takarmány-alapanyagok. Chlorella termesztik üzleti szempontból, hogy a hal étel: zooplankton táplálják, és ezek viszont betakarított gazdaságok halak takarmányozására. Ez egy anyagi eszközök-ból napfény az élelmiszer olyan módon, több kényelmes és ellenőrizhető, mint a rendes gazdálkodás.
Industry:Biotechnology
Grote molecules van RNA, die onbewerkte mRNA afschriften of pre-mRNAs gevonden in de nucleous van een eukaryote cel.
Industry:Biotechnology
Het proces van een mengsel te scheiden van de meer vluchtige van de minder verwarming vluchtige delen, en vervolgens koeling en de resulterende damp te produceren een meer bijna zuiver of geraffineerde stof condenserend.
Industry:Biotechnology
© 2026 CSOFT International, Ltd.